ID: 927972902_927972906

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 927972902 927972906
Species Human (GRCh38) Human (GRCh38)
Location 2:27316822-27316844 2:27316847-27316869
Sequence CCAATGACAGGCTGGGCGTGGAG CAGCGAGCAGATGCTGGCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 360} {0: 1, 1: 0, 2: 1, 3: 19, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!