ID: 927980442_927980447

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 927980442 927980447
Species Human (GRCh38) Human (GRCh38)
Location 2:27371295-27371317 2:27371322-27371344
Sequence CCTGCACTGTCGGGTGCGCTACA GCTCCTGGGGCTGCACGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 25} {0: 1, 1: 0, 2: 0, 3: 37, 4: 355}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!