ID: 927982140_927982146

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 927982140 927982146
Species Human (GRCh38) Human (GRCh38)
Location 2:27380750-27380772 2:27380781-27380803
Sequence CCAGCTGGTACCTCCGTACTCGC CCGCCGCCGCAGAGACGCACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 32} {0: 1, 1: 0, 2: 3, 3: 5, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!