ID: 927982143_927982152

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 927982143 927982152
Species Human (GRCh38) Human (GRCh38)
Location 2:27380775-27380797 2:27380809-27380831
Sequence CCGCTTCCGCCGCCGCAGAGACG TAGTCCGTGGGAAGCGGCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 107} {0: 1, 1: 0, 2: 1, 3: 4, 4: 30}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!