ID: 927982145_927982149

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 927982145 927982149
Species Human (GRCh38) Human (GRCh38)
Location 2:27380781-27380803 2:27380796-27380818
Sequence CCGCCGCCGCAGAGACGCACGGG CGCACGGGACGCGTAGTCCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 62} {0: 1, 1: 0, 2: 0, 3: 0, 4: 33}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!