ID: 927984831_927984835

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 927984831 927984835
Species Human (GRCh38) Human (GRCh38)
Location 2:27402057-27402079 2:27402107-27402129
Sequence CCTGTATACACATTTTCAAATAC CTGCTAGCATTGGGTCAAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 367} {0: 1, 1: 0, 2: 0, 3: 4, 4: 65}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!