ID: 927988187_927988202

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 927988187 927988202
Species Human (GRCh38) Human (GRCh38)
Location 2:27428536-27428558 2:27428581-27428603
Sequence CCCGCCCACCCAGAACGTCACCC GGCACCGCCCATCGTTGGTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 192} {0: 1, 1: 0, 2: 0, 3: 3, 4: 19}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!