ID: 927988189_927988203

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 927988189 927988203
Species Human (GRCh38) Human (GRCh38)
Location 2:27428540-27428562 2:27428582-27428604
Sequence CCCACCCAGAACGTCACCCAATG GCACCGCCCATCGTTGGTCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 103} {0: 1, 1: 0, 2: 0, 3: 0, 4: 35}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!