ID: 927988193_927988201

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 927988193 927988201
Species Human (GRCh38) Human (GRCh38)
Location 2:27428545-27428567 2:27428576-27428598
Sequence CCAGAACGTCACCCAATGGAAAC GGTGCGGCACCGCCCATCGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 68} {0: 1, 1: 0, 2: 0, 3: 1, 4: 23}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!