ID: 927992535_927992540

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 927992535 927992540
Species Human (GRCh38) Human (GRCh38)
Location 2:27458220-27458242 2:27458255-27458277
Sequence CCAGCTGTGGAGGCACAGAGGCA ATCCAATTCCCCAGGGAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 51, 4: 303} {0: 1, 1: 0, 2: 1, 3: 18, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!