ID: 927999862_927999866

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 927999862 927999866
Species Human (GRCh38) Human (GRCh38)
Location 2:27514059-27514081 2:27514101-27514123
Sequence CCTGATCTTGTTAGTGGGTTCTA CTAGGTATGTTCACTGCTACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 95} {0: 1, 1: 2, 2: 16, 3: 132, 4: 334}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!