ID: 928051475_928051477

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 928051475 928051477
Species Human (GRCh38) Human (GRCh38)
Location 2:28001032-28001054 2:28001046-28001068
Sequence CCAAGATCTTAGTGCCAGATGTG CCAGATGTGCTTGTTGCTACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 41, 4: 268} {0: 1, 1: 4, 2: 28, 3: 68, 4: 282}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!