ID: 928068227_928068229

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 928068227 928068229
Species Human (GRCh38) Human (GRCh38)
Location 2:28188292-28188314 2:28188325-28188347
Sequence CCTTAAACAGCCTTGTATTCTTT CATTTGAAACTGATTTACTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 303} {0: 1, 1: 0, 2: 0, 3: 10, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!