ID: 928102953_928102955

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 928102953 928102955
Species Human (GRCh38) Human (GRCh38)
Location 2:28450018-28450040 2:28450039-28450061
Sequence CCTGTGATGACATCATCATTACC CCTTGAATTCTCAGAATCACCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 16, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!