ID: 928170395_928170400

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 928170395 928170400
Species Human (GRCh38) Human (GRCh38)
Location 2:28999498-28999520 2:28999512-28999534
Sequence CCACCCACTTCCAGGTCAAGGGC GTCAAGGGCCGCAGGCCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 239} {0: 1, 1: 0, 2: 1, 3: 9, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!