ID: 928175801_928175812

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 928175801 928175812
Species Human (GRCh38) Human (GRCh38)
Location 2:29033628-29033650 2:29033670-29033692
Sequence CCATGGCCAGGGGTGGCTCTGGG GTATCGCTGAGACCTAGTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 57, 4: 521} {0: 1, 1: 0, 2: 0, 3: 1, 4: 36}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!