ID: 928176334_928176341

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 928176334 928176341
Species Human (GRCh38) Human (GRCh38)
Location 2:29036753-29036775 2:29036793-29036815
Sequence CCTGGGTGAGTGTCCCACGTGGG ACCATGTCCACCCTCCTGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 109} {0: 1, 1: 0, 2: 5, 3: 12, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!