ID: 928180005_928180013

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 928180005 928180013
Species Human (GRCh38) Human (GRCh38)
Location 2:29062294-29062316 2:29062329-29062351
Sequence CCTATGGCAGGAGCCTCGCCCTG TTGGCCCCAAGCAAACGTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 164} {0: 1, 1: 0, 2: 2, 3: 3, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!