ID: 928185384_928185388

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 928185384 928185388
Species Human (GRCh38) Human (GRCh38)
Location 2:29105512-29105534 2:29105535-29105557
Sequence CCTGTCTCCAGAGGGCAGCCTCT CCATCTCAGTGTAACATTCAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 36, 4: 293} {0: 1, 1: 0, 2: 1, 3: 13, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!