ID: 928189383_928189394

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 928189383 928189394
Species Human (GRCh38) Human (GRCh38)
Location 2:29148170-29148192 2:29148200-29148222
Sequence CCTTGACAGCCCTGGGAGCCCCA GCTAAGCTACTTAAGGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 348} {0: 1, 1: 0, 2: 0, 3: 6, 4: 70}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!