ID: 928200132_928200138

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 928200132 928200138
Species Human (GRCh38) Human (GRCh38)
Location 2:29242612-29242634 2:29242649-29242671
Sequence CCAAGTCATCTGCTGGTTCTTGT CTGTGTGACCTGAGGCAACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 171} {0: 1, 1: 0, 2: 3, 3: 27, 4: 233}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!