ID: 928213140_928213145

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 928213140 928213145
Species Human (GRCh38) Human (GRCh38)
Location 2:29338880-29338902 2:29338911-29338933
Sequence CCTTCCCCAGTCTCCATTTCAAT TTCTACAATGTGCCCAGCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 40, 4: 473} {0: 1, 1: 1, 2: 5, 3: 25, 4: 260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!