ID: 928213140_928213146

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 928213140 928213146
Species Human (GRCh38) Human (GRCh38)
Location 2:29338880-29338902 2:29338912-29338934
Sequence CCTTCCCCAGTCTCCATTTCAAT TCTACAATGTGCCCAGCACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 40, 4: 473} {0: 1, 1: 2, 2: 7, 3: 65, 4: 481}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!