ID: 928221773_928221776

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 928221773 928221776
Species Human (GRCh38) Human (GRCh38)
Location 2:29409312-29409334 2:29409363-29409385
Sequence CCTTCCTTTTTCTCCTTCTACTG AGTCTCAGTGCTGCTTTCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 127, 4: 1227} {0: 1, 1: 0, 2: 3, 3: 34, 4: 289}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!