ID: 928242700_928242706

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 928242700 928242706
Species Human (GRCh38) Human (GRCh38)
Location 2:29600563-29600585 2:29600595-29600617
Sequence CCTAAGCCTGCTGGGAGATGGGC GTTTCAGGCTGATATCGTGGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 18, 4: 287} {0: 1, 1: 0, 2: 0, 3: 1, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!