ID: 928254140_928254152

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 928254140 928254152
Species Human (GRCh38) Human (GRCh38)
Location 2:29707380-29707402 2:29707430-29707452
Sequence CCCAGTCCAGTTGGGGGATGAAC CAGGGAAAACAGAACAAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 59} {0: 1, 1: 0, 2: 2, 3: 47, 4: 695}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!