ID: 928256703_928256714

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 928256703 928256714
Species Human (GRCh38) Human (GRCh38)
Location 2:29729096-29729118 2:29729145-29729167
Sequence CCTGGAACCCAGCCACTAAACCT ATTACCTTCTGGAAAAGTGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 210} {0: 1, 1: 0, 2: 2, 3: 20, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!