ID: 928275254_928275258

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 928275254 928275258
Species Human (GRCh38) Human (GRCh38)
Location 2:29894754-29894776 2:29894775-29894797
Sequence CCCTTTTAATTCTCAACTATTTT TTGCTTTTCTAGGAGGATGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 94, 4: 973} {0: 1, 1: 0, 2: 0, 3: 24, 4: 278}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!