ID: 928281314_928281319

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 928281314 928281319
Species Human (GRCh38) Human (GRCh38)
Location 2:29948831-29948853 2:29948865-29948887
Sequence CCACTGACAGGAGCAAAAATCCG TCCCACTAACTGAAACGTCATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 9, 4: 67}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!