ID: 928304304_928304306

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 928304304 928304306
Species Human (GRCh38) Human (GRCh38)
Location 2:30153848-30153870 2:30153870-30153892
Sequence CCAGTAAAAATACTTGGGTAAAG GAGAAAAAATAGATGGAATCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 168} {0: 1, 1: 0, 2: 1, 3: 40, 4: 489}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!