ID: 928312123_928312129

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 928312123 928312129
Species Human (GRCh38) Human (GRCh38)
Location 2:30219912-30219934 2:30219933-30219955
Sequence CCTACCATACACCATAGGGAGTT TTTTCTGGGATGGAGTTTCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 49, 4: 317}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!