ID: 928318929_928318934

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 928318929 928318934
Species Human (GRCh38) Human (GRCh38)
Location 2:30268163-30268185 2:30268196-30268218
Sequence CCGAGGAGATGATGCTCCAGCCC TACAGTAGTGTGCAACCCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 261} {0: 1, 1: 0, 2: 1, 3: 7, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!