ID: 928321384_928321388

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 928321384 928321388
Species Human (GRCh38) Human (GRCh38)
Location 2:30285183-30285205 2:30285211-30285233
Sequence CCAATCTGACAATCTCTGCCTTT GGGATATTTACACCATTTGAAGG
Strand - +
Off-target summary {0: 13, 1: 94, 2: 271, 3: 517, 4: 1734} {0: 1, 1: 0, 2: 2, 3: 11, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!