ID: 928331306_928331313

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 928331306 928331313
Species Human (GRCh38) Human (GRCh38)
Location 2:30359989-30360011 2:30360025-30360047
Sequence CCTGCCGTGGTTATCAGCTGAAG GAGTGTGGACAGAGGGCAGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 9, 3: 81, 4: 706}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!