ID: 928347674_928347680

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 928347674 928347680
Species Human (GRCh38) Human (GRCh38)
Location 2:30516323-30516345 2:30516359-30516381
Sequence CCGTCCACCACTGCTGAACGTCG GCCATTGACTTTCACCGCTCTGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 9, 3: 28, 4: 152} {0: 1, 1: 1, 2: 10, 3: 42, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!