ID: 928348185_928348188

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 928348185 928348188
Species Human (GRCh38) Human (GRCh38)
Location 2:30519878-30519900 2:30519892-30519914
Sequence CCATCCACCACTGCTGAATGCCA TGAATGCCACCTTCTCAGACTGG
Strand - +
Off-target summary {0: 2, 1: 7, 2: 61, 3: 116, 4: 312} {0: 1, 1: 0, 2: 5, 3: 56, 4: 334}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!