|
Left Crispr |
Right Crispr |
| Crispr ID |
928348185 |
928348193 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:30519878-30519900
|
2:30519920-30519942
|
| Sequence |
CCATCCACCACTGCTGAATGCCA |
GACTTTCACCCCTCTGGATCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 7, 2: 61, 3: 116, 4: 312} |
{0: 2, 1: 33, 2: 76, 3: 91, 4: 165} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|