ID: 928398292_928398301

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 928398292 928398301
Species Human (GRCh38) Human (GRCh38)
Location 2:30959947-30959969 2:30959984-30960006
Sequence CCTCCTCCCAGGAGGACCCTTCT GAGCACTACCCCTTCTATGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 53, 4: 405} {0: 1, 1: 1, 2: 2, 3: 3, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!