ID: 928420145_928420153

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 928420145 928420153
Species Human (GRCh38) Human (GRCh38)
Location 2:31132052-31132074 2:31132076-31132098
Sequence CCCAGCCTGACTAAAAGAGATTC ATCTGCAGGTCCCTGGGACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 144} {0: 1, 1: 0, 2: 6, 3: 55, 4: 300}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!