ID: 928420506_928420515

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 928420506 928420515
Species Human (GRCh38) Human (GRCh38)
Location 2:31134695-31134717 2:31134726-31134748
Sequence CCCCTGGGAGCTCTCCAAGGGTG GGGATGAGCCAAGGGAGCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 199} {0: 1, 1: 0, 2: 1, 3: 15, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!