ID: 928427851_928427854

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 928427851 928427854
Species Human (GRCh38) Human (GRCh38)
Location 2:31193356-31193378 2:31193381-31193403
Sequence CCATGGGGAGGGTGAAACGGAGC TGGGCATCCCAGCCCTCTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 213} {0: 1, 1: 1, 2: 11, 3: 59, 4: 280}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!