ID: 928435781_928435799

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 928435781 928435799
Species Human (GRCh38) Human (GRCh38)
Location 2:31253691-31253713 2:31253743-31253765
Sequence CCTTGCTCAGGGTGTGGACCCTC GGGAAGAAGGCTGGGGTGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 161} {0: 1, 1: 0, 2: 8, 3: 64, 4: 655}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!