ID: 928460956_928460964

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 928460956 928460964
Species Human (GRCh38) Human (GRCh38)
Location 2:31472127-31472149 2:31472165-31472187
Sequence CCACCTTTTGCTCTACTCAGGCC AAGGCCACCTACACTGGGCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 27, 4: 229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!