ID: 928470714_928470717

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 928470714 928470717
Species Human (GRCh38) Human (GRCh38)
Location 2:31573090-31573112 2:31573106-31573128
Sequence CCCAGAAATCTGGGAACAGGCCA CAGGCCATTCTTCAAGGACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 264} {0: 1, 1: 0, 2: 2, 3: 28, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!