ID: 928511689_928511696

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 928511689 928511696
Species Human (GRCh38) Human (GRCh38)
Location 2:32009830-32009852 2:32009848-32009870
Sequence CCTGCAAGCCAGAGGCGGCGACA CGACAAGTCGGCTGGGGTCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 83} {0: 1, 1: 0, 2: 0, 3: 3, 4: 65}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!