ID: 928518193_928518203

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 928518193 928518203
Species Human (GRCh38) Human (GRCh38)
Location 2:32063622-32063644 2:32063656-32063678
Sequence CCGACTGCAGGAGGAGAAGGGGT CCGAGGAAGGAGAAAGGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 320} {0: 1, 1: 0, 2: 3, 3: 72, 4: 651}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!