|
Left Crispr |
Right Crispr |
| Crispr ID |
928518886 |
928518890 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:32068723-32068745
|
2:32068742-32068764
|
| Sequence |
CCTTTAAAAATGAAGTAAAACTT |
ACTTTAGCCGGATGTGGTGGCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 2, 2: 10, 3: 128, 4: 1093} |
{0: 1, 1: 5, 2: 469, 3: 8569, 4: 39249} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|