|
Left Crispr |
Right Crispr |
| Crispr ID |
928544392 |
928544397 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:32315632-32315654
|
2:32315651-32315673
|
| Sequence |
CCAGCTACTGAGGCAGGAGAGTG |
AGTGGCATGAACCCGGGAGGCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 13, 2: 49, 3: 230, 4: 3380} |
{0: 47, 1: 4984, 2: 31948, 3: 62314, 4: 116351} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|