ID: 928556005_928556009

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 928556005 928556009
Species Human (GRCh38) Human (GRCh38)
Location 2:32425883-32425905 2:32425912-32425934
Sequence CCAGCCAGCTGCTTCCAGCACAT CTTTCCCCCACAGCTGTGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 281} {0: 1, 1: 0, 2: 1, 3: 33, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!