ID: 928603572_928603575

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 928603572 928603575
Species Human (GRCh38) Human (GRCh38)
Location 2:32924089-32924111 2:32924111-32924133
Sequence CCTACACTTTGGGAGGCTGAAGC CAGGTAGATCATCTGACGTTGGG
Strand - +
Off-target summary {0: 263, 1: 7855, 2: 78645, 3: 193131, 4: 233854} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!